Review



human miltenyi 130 046 703 cd45 fitc bd biosciences 555482  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Miltenyi Biotec human miltenyi 130 046 703 cd45 fitc bd biosciences 555482
    Human Miltenyi 130 046 703 Cd45 Fitc Bd Biosciences 555482, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1629 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/CD34+MicroBead+Kit%2C+human/pm41903134-239-62-63
    Average 97 stars, based on 1629 article reviews
    human miltenyi 130 046 703 cd45 fitc bd biosciences 555482 - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Isolation:

    Article Title: Isolated naive pluripotent stem cells and methods of generating same
    Article Snippet: .. Hematopoietic cells are isolated using fluorescently-labeled antibodies such as CD34-FITC, CD45-PE, CD31-PE, CD38-PE, CD90-FITC, CD117-PE, CD15-FITC, class I-FITC, all of which IgGI are available from PharMingen, CD133/1-PE (IgGI) (available from Miltenyi Biotec, Auburn, CA), and glycophorin A-PE (IgGI), available from Immunotech (Miami, FL). .. Live cells (i.e., without fixation) are analyzed on a FACScan (Becton Dickinson Bio Sciences) by using propidium iodide to exclude dead cells with either the PC-LYSIS or the CELLQUEST software.

    Incubation:

    Article Title: Robust differentiation and potent immunomodulation of human mesenchymal stromal cells cultured with a xeno-free GMP protein supplement.
    Article Snippet: Background/Aims: Human mesenchymal stromal cells (hMSC) are multipotent adult cells commonly used in regenerative medicine as advanced therapy medicinal products.. The expansion of these cells in xeno-free supplements is highly encouraged by regulatory agencies due to safety concerns.. However, the number of supplements with robust performance and consistency for hMSC expansion are limited.

    Article Title: Synergistic Effect of Human Chorionic Gonadotropin and Granulocyte Colony Stimulating Factor in the Mobilization of HSPCs Improves Overall Survival After PBSCT in a Preclinical Murine Model. Are We Far Enough for Therapy?
    Article Snippet: Strategies to improve hematopoietic stem and progenitor cell (HSPC) mobilization from the bone marrow can have a pivotal role in addressing iatrogenic bone-marrow insufficiency from chemo(radio)therapy and overcoming peripheral blood stem cell transplantation (PBSCT) limitations such as insufficient mobilization.. Granulocyte-colony stimulating factor (G-CSF) represents the standard mobilization strategy for HSPC and has done so for more than three decades since its FDA approval.. Its association with non–G-CSF agents is often employed for difficult HSPC mobilization.

    Bioprocessing:

    Article Title: Robust differentiation and potent immunomodulation of human mesenchymal stromal cells cultured with a xeno-free GMP protein supplement.
    Article Snippet: Background/Aims: Human mesenchymal stromal cells (hMSC) are multipotent adult cells commonly used in regenerative medicine as advanced therapy medicinal products.. The expansion of these cells in xeno-free supplements is highly encouraged by regulatory agencies due to safety concerns.. However, the number of supplements with robust performance and consistency for hMSC expansion are limited.

    Article Title: Synergistic Effect of Human Chorionic Gonadotropin and Granulocyte Colony Stimulating Factor in the Mobilization of HSPCs Improves Overall Survival After PBSCT in a Preclinical Murine Model. Are We Far Enough for Therapy?
    Article Snippet: Strategies to improve hematopoietic stem and progenitor cell (HSPC) mobilization from the bone marrow can have a pivotal role in addressing iatrogenic bone-marrow insufficiency from chemo(radio)therapy and overcoming peripheral blood stem cell transplantation (PBSCT) limitations such as insufficient mobilization.. Granulocyte-colony stimulating factor (G-CSF) represents the standard mobilization strategy for HSPC and has done so for more than three decades since its FDA approval.. Its association with non–G-CSF agents is often employed for difficult HSPC mobilization.

    FACS:

    Article Title: Transcriptional Responses of In Vitro Blood–Brain Barrier Models to Shear Stress
    Article Snippet: .. Cells were then lifted and sorted via magnetic activated cell sorting (MACS) using the Stem Cell Technologies EasySep Human FITC Positive Selection Kit II (Gibco, Waltham, MA, USA), using either the CD34-FITC (Miltenyi Biotec, Charlestown, MA, USA) or CD31-FITC (BD Biosciences, Franklin Lakes, NJ, USA) antibodies for positive selection. .. Cells were resuspended in HECSR (HESFM (Gibco, Waltham, MA, USA) + B-27 (Gibco, Waltham, MA, USA)) + 10% DMSO (Sigma-Aldrich, St. Louis, MO, USA) + 30% FBS (Gibco, Waltham, MA, USA) at ~5 million cells/cm 2 ; 1 mL vials (Thermofisher Scientific, Waltham, MA, USA) were then frozen in a freezing container (ULAB, Memphis, TN, USA) following the manufacturers’ instructions at −80 °C for at least overnight before being banked in liquid nitrogen for long-term storage.

    Article Title: Transcriptional Responses of In Vitro Blood-Brain Barrier Models to Shear Stress.
    Article Snippet: .. Cells were then lifted and sorted via magnetic activated cell sorting (MACS) using the Stem Cell Technologies EasySep Human FITC Positive Selection Kit II (Gibco, Waltham, MA, USA), using either the CD34-FITC (Miltenyi Biotec, Charlestown, MA, USA) or CD31-FITC (BD Biosciences, Franklin Lakes, NJ, USA) antibodies for positive selection. .. Cells were resuspended in HECSR (HESFM (Gibco, Waltham, MA, USA) + B-27 (Gibco, Waltham, MA, USA)) + 10% DMSO (Sigma-Aldrich, St. Louis, MO, USA) + 30% FBS (Gibco, Waltham, MA, USA) at ~5 million cells/cm2; 1 mL vials (Thermofisher Scientific, Waltham, MA, USA) were then frozen in a freezing container (ULAB, Memphis, TN, USA) following the manufacturers’ instructions at −80 ◦C for at least overnight before being banked in liquid nitrogen for long-term storage.

    Magnetic Cell Separation:

    Article Title: Transcriptional Responses of In Vitro Blood–Brain Barrier Models to Shear Stress
    Article Snippet: .. Cells were then lifted and sorted via magnetic activated cell sorting (MACS) using the Stem Cell Technologies EasySep Human FITC Positive Selection Kit II (Gibco, Waltham, MA, USA), using either the CD34-FITC (Miltenyi Biotec, Charlestown, MA, USA) or CD31-FITC (BD Biosciences, Franklin Lakes, NJ, USA) antibodies for positive selection. .. Cells were resuspended in HECSR (HESFM (Gibco, Waltham, MA, USA) + B-27 (Gibco, Waltham, MA, USA)) + 10% DMSO (Sigma-Aldrich, St. Louis, MO, USA) + 30% FBS (Gibco, Waltham, MA, USA) at ~5 million cells/cm 2 ; 1 mL vials (Thermofisher Scientific, Waltham, MA, USA) were then frozen in a freezing container (ULAB, Memphis, TN, USA) following the manufacturers’ instructions at −80 °C for at least overnight before being banked in liquid nitrogen for long-term storage.

    Article Title: Transcriptional Responses of In Vitro Blood-Brain Barrier Models to Shear Stress.
    Article Snippet: .. Cells were then lifted and sorted via magnetic activated cell sorting (MACS) using the Stem Cell Technologies EasySep Human FITC Positive Selection Kit II (Gibco, Waltham, MA, USA), using either the CD34-FITC (Miltenyi Biotec, Charlestown, MA, USA) or CD31-FITC (BD Biosciences, Franklin Lakes, NJ, USA) antibodies for positive selection. .. Cells were resuspended in HECSR (HESFM (Gibco, Waltham, MA, USA) + B-27 (Gibco, Waltham, MA, USA)) + 10% DMSO (Sigma-Aldrich, St. Louis, MO, USA) + 30% FBS (Gibco, Waltham, MA, USA) at ~5 million cells/cm2; 1 mL vials (Thermofisher Scientific, Waltham, MA, USA) were then frozen in a freezing container (ULAB, Memphis, TN, USA) following the manufacturers’ instructions at −80 ◦C for at least overnight before being banked in liquid nitrogen for long-term storage.

    Selection:

    Article Title: Transcriptional Responses of In Vitro Blood–Brain Barrier Models to Shear Stress
    Article Snippet: .. Cells were then lifted and sorted via magnetic activated cell sorting (MACS) using the Stem Cell Technologies EasySep Human FITC Positive Selection Kit II (Gibco, Waltham, MA, USA), using either the CD34-FITC (Miltenyi Biotec, Charlestown, MA, USA) or CD31-FITC (BD Biosciences, Franklin Lakes, NJ, USA) antibodies for positive selection. .. Cells were resuspended in HECSR (HESFM (Gibco, Waltham, MA, USA) + B-27 (Gibco, Waltham, MA, USA)) + 10% DMSO (Sigma-Aldrich, St. Louis, MO, USA) + 30% FBS (Gibco, Waltham, MA, USA) at ~5 million cells/cm 2 ; 1 mL vials (Thermofisher Scientific, Waltham, MA, USA) were then frozen in a freezing container (ULAB, Memphis, TN, USA) following the manufacturers’ instructions at −80 °C for at least overnight before being banked in liquid nitrogen for long-term storage.

    Article Title: Transcriptional Responses of In Vitro Blood-Brain Barrier Models to Shear Stress.
    Article Snippet: .. Cells were then lifted and sorted via magnetic activated cell sorting (MACS) using the Stem Cell Technologies EasySep Human FITC Positive Selection Kit II (Gibco, Waltham, MA, USA), using either the CD34-FITC (Miltenyi Biotec, Charlestown, MA, USA) or CD31-FITC (BD Biosciences, Franklin Lakes, NJ, USA) antibodies for positive selection. .. Cells were resuspended in HECSR (HESFM (Gibco, Waltham, MA, USA) + B-27 (Gibco, Waltham, MA, USA)) + 10% DMSO (Sigma-Aldrich, St. Louis, MO, USA) + 30% FBS (Gibco, Waltham, MA, USA) at ~5 million cells/cm2; 1 mL vials (Thermofisher Scientific, Waltham, MA, USA) were then frozen in a freezing container (ULAB, Memphis, TN, USA) following the manufacturers’ instructions at −80 ◦C for at least overnight before being banked in liquid nitrogen for long-term storage.

    Amplification:

    Article Title: Deciphering the complex clonal heterogeneity of polycythemia vera and the response to interferon alfa
    Article Snippet: FORWARD ** AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACG ACGCTC locus-specific amplification SHORT_INT_FOR ** AATGATACGGCGACCACCGAG ATCT locus-specific amplification JAK2_PRIMER1 ** ACCAACCTCACCAACATTACAG AGGCCT locus-specific amplification JAK2_PRIMER2 ** AGGAGACTACGGTCAACTGCA TGAAACAGA locus-specific amplification JAK2_PRIMER3 ** GCAGCAAGTATGATGAGCAAG CTTTCTCACA locus-specific amplification JAK2_PRIMER4 ** GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTGCAGCAAG TATGATGAGCAA locus-specific amplification Table S4: List of all antibodies used for flow cytometry Antibody, clone Company Dilutio n CD235a-PC7, 11E4B Beckman Coulter 1:50 CD235a-APC, REA175 Miltenyi Biotec 1:200 CD34-FITC, 581 Beckman Coulter 1:50 CD45-APC, J33 Beckman Coulter 1:50 CD45-APC-Vio770, REA747 Miltenyi Biotec 1:200 CD45-PB, J33 Beckman Coulter 1:50 CD71-FITC, M-A712 BD Pharmingen 1:50 IFNAR1-FITC, MMHAR-1 PBL Assay Science 1:25 IFNAR2-PE, REA124 Miltenyi Biotec 1:25 References 1. .. FORWARD ** AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACG ACGCTC locus-specific amplification SHORT_INT_FOR ** AATGATACGGCGACCACCGAG ATCT locus-specific amplification JAK2_PRIMER1 ** ACCAACCTCACCAACATTACAG AGGCCT locus-specific amplification JAK2_PRIMER2 ** AGGAGACTACGGTCAACTGCA TGAAACAGA locus-specific amplification JAK2_PRIMER3 ** GCAGCAAGTATGATGAGCAAG CTTTCTCACA locus-specific amplification JAK2_PRIMER4 ** GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTGCAGCAAG TATGATGAGCAA locus-specific amplification Table S4: List of all antibodies used for flow cytometry Antibody, clone Company Dilutio n CD235a-PC7, 11E4B Beckman Coulter 1:50 CD235a-APC, REA175 Miltenyi Biotec 1:200 CD34-FITC, 581 Beckman Coulter 1:50 CD45-APC, J33 Beckman Coulter 1:50 CD45-APC-Vio770, REA747 Miltenyi Biotec 1:200 CD45-PB, J33 Beckman Coulter 1:50 CD71-FITC, M-A712 BD Pharmingen 1:50 IFNAR1-FITC, MMHAR-1 PBL Assay Science 1:25 IFNAR2-PE, REA124 Miltenyi Biotec 1:25 References 1. ..

    Flow Cytometry:

    Article Title: Deciphering the complex clonal heterogeneity of polycythemia vera and the response to interferon alfa
    Article Snippet: FORWARD ** AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACG ACGCTC locus-specific amplification SHORT_INT_FOR ** AATGATACGGCGACCACCGAG ATCT locus-specific amplification JAK2_PRIMER1 ** ACCAACCTCACCAACATTACAG AGGCCT locus-specific amplification JAK2_PRIMER2 ** AGGAGACTACGGTCAACTGCA TGAAACAGA locus-specific amplification JAK2_PRIMER3 ** GCAGCAAGTATGATGAGCAAG CTTTCTCACA locus-specific amplification JAK2_PRIMER4 ** GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTGCAGCAAG TATGATGAGCAA locus-specific amplification Table S4: List of all antibodies used for flow cytometry Antibody, clone Company Dilutio n CD235a-PC7, 11E4B Beckman Coulter 1:50 CD235a-APC, REA175 Miltenyi Biotec 1:200 CD34-FITC, 581 Beckman Coulter 1:50 CD45-APC, J33 Beckman Coulter 1:50 CD45-APC-Vio770, REA747 Miltenyi Biotec 1:200 CD45-PB, J33 Beckman Coulter 1:50 CD71-FITC, M-A712 BD Pharmingen 1:50 IFNAR1-FITC, MMHAR-1 PBL Assay Science 1:25 IFNAR2-PE, REA124 Miltenyi Biotec 1:25 References 1. .. FORWARD ** AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACG ACGCTC locus-specific amplification SHORT_INT_FOR ** AATGATACGGCGACCACCGAG ATCT locus-specific amplification JAK2_PRIMER1 ** ACCAACCTCACCAACATTACAG AGGCCT locus-specific amplification JAK2_PRIMER2 ** AGGAGACTACGGTCAACTGCA TGAAACAGA locus-specific amplification JAK2_PRIMER3 ** GCAGCAAGTATGATGAGCAAG CTTTCTCACA locus-specific amplification JAK2_PRIMER4 ** GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTGCAGCAAG TATGATGAGCAA locus-specific amplification Table S4: List of all antibodies used for flow cytometry Antibody, clone Company Dilutio n CD235a-PC7, 11E4B Beckman Coulter 1:50 CD235a-APC, REA175 Miltenyi Biotec 1:200 CD34-FITC, 581 Beckman Coulter 1:50 CD45-APC, J33 Beckman Coulter 1:50 CD45-APC-Vio770, REA747 Miltenyi Biotec 1:200 CD45-PB, J33 Beckman Coulter 1:50 CD71-FITC, M-A712 BD Pharmingen 1:50 IFNAR1-FITC, MMHAR-1 PBL Assay Science 1:25 IFNAR2-PE, REA124 Miltenyi Biotec 1:25 References 1. ..

    Article Title: Hsa-miR-532-3p protects human decidual mesenchymal stem cells from oxidative stress in recurrent spontaneous abortion via targeting KEAP1
    Article Snippet: .. The following markers of hDMSCs were detected by flow cytometry (FC) (BDLSRFortessa): CD3-FITC (1:100, Southern Biotechnology, 9515-02S), CD29-FITC(1:100, Miltenyi, 130-123-692), CD34-FITC(1:100, Miltenyi, 130-113-740), CD44-FITC(1:100, Miltenyi, 130-124-856), CD45-FITC(1:100, Miltenyi, 130-110-631), CD73-FITC (1:100, TRAN, HF101-01), CD90-FITC (1:100, Miltenyi, 130-114-901), and CD105-FITC (1:100, Miltenyi, 130-112-169). ..

    Article Title: Hsa-miR-532-3p protects human decidual mesenchymal stem cells from oxidative stress in recurrent spontaneous abortion via targeting KEAP1.
    Article Snippet: .. The following markers of hDMSCs were detected by flow cytometry (FC) (BDLSRFortessa): CD3-FITC (1:100, Southern Biotechnology, 9515-02S), CD29-FITC(1:100, Miltenyi, 130-123-692), CD34-FITC (1:100, Miltenyi, 130-113-740), CD44-FITC(1:100, Miltenyi, 130-124- 856), CD45-FITC(1:100, Miltenyi, 130-110-631), CD73-FITC (1:100, TRAN, HF101-01), CD90-FITC (1:100, Miltenyi, 130-114-901), and CD105-FITC (1:100, Miltenyi, 130-112-169). ..

    Clinical Proteomics:

    Article Title: Synergistic Effect of Human Chorionic Gonadotropin and Granulocyte Colony Stimulating Factor in the Mobilization of HSPCs Improves Overall Survival After PBSCT in a Preclinical Murine Model. Are We Far Enough for Therapy?
    Article Snippet: Strategies to improve hematopoietic stem and progenitor cell (HSPC) mobilization from the bone marrow can have a pivotal role in addressing iatrogenic bone-marrow insufficiency from chemo(radio)therapy and overcoming peripheral blood stem cell transplantation (PBSCT) limitations such as insufficient mobilization.. Granulocyte-colony stimulating factor (G-CSF) represents the standard mobilization strategy for HSPC and has done so for more than three decades since its FDA approval.. Its association with non–G-CSF agents is often employed for difficult HSPC mobilization.

    Control:

    Article Title: Synergistic Effect of Human Chorionic Gonadotropin and Granulocyte Colony Stimulating Factor in the Mobilization of HSPCs Improves Overall Survival After PBSCT in a Preclinical Murine Model. Are We Far Enough for Therapy?
    Article Snippet: Strategies to improve hematopoietic stem and progenitor cell (HSPC) mobilization from the bone marrow can have a pivotal role in addressing iatrogenic bone-marrow insufficiency from chemo(radio)therapy and overcoming peripheral blood stem cell transplantation (PBSCT) limitations such as insufficient mobilization.. Granulocyte-colony stimulating factor (G-CSF) represents the standard mobilization strategy for HSPC and has done so for more than three decades since its FDA approval.. Its association with non–G-CSF agents is often employed for difficult HSPC mobilization.



    Similar Products

    human miltenyi 130 046 703 cd45 fitc bd biosciences 555482  (Miltenyi Biotec)
    97
    Miltenyi Biotec human miltenyi 130 046 703 cd45 fitc bd biosciences 555482
    Human Miltenyi 130 046 703 Cd45 Fitc Bd Biosciences 555482, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/CD34+MicroBead+Kit%2C+human/pm41903134-239-62-63
    Average 97 stars, based on 1 article reviews
    human miltenyi 130 046 703 cd45 fitc bd biosciences 555482 - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    anti rat fluorescein isothiocyanate fitc conjugated cd34 antibody  (Thermo Fisher)
    99
    Thermo Fisher anti rat fluorescein isothiocyanate fitc conjugated cd34 antibody
    Anti Rat Fluorescein Isothiocyanate Fitc Conjugated Cd34 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/Fluorescein/pm41266720-73-25-31
    Average 99 stars, based on 1 article reviews
    anti rat fluorescein isothiocyanate fitc conjugated cd34 antibody - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cd34  (Sino Biological)
    93
    Sino Biological cd34
    Cd34, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/CD34+Antibody+(FITC)%2C+Mouse+Mab/pm41013639-93-30-33
    Average 93 stars, based on 1 article reviews
    cd34 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    cd34 fitc  (Miltenyi Biotec)
    94
    Miltenyi Biotec cd34 fitc
    Cd34 Fitc, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/ErbB-2+(CD340)+Antibody%2C+anti-human/us12570957-1361-9-30
    Average 94 stars, based on 1 article reviews
    cd34 fitc - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    fitc conjugated anti cd34  (4A Biotech)
    86
    4A Biotech fitc conjugated anti cd34
    Fitc Conjugated Anti Cd34, supplied by 4A Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/anti+cd34+conjugated+fitc/pm41432050-435-11-13
    Average 86 stars, based on 1 article reviews
    fitc conjugated anti cd34 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    fitc  (Miltenyi Biotec)
    93
    Miltenyi Biotec fitc
    Fitc, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/CD34+Antibody%2C+anti-mouse%2C+REAfinity/pmc12547733-4-4-13
    Average 93 stars, based on 1 article reviews
    fitc - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    fluorescein isothiocyanate fitc conjugated cd34  (Miltenyi Biotec)
    96
    Miltenyi Biotec fluorescein isothiocyanate fitc conjugated cd34
    Fluorescein Isothiocyanate Fitc Conjugated Cd34, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/CD34+Antibody%2C+anti-human%2C+FITC/pm40830621-78-15-25
    Average 96 stars, based on 1 article reviews
    fluorescein isothiocyanate fitc conjugated cd34 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    fitc conjugated anti cd34  (Bio-Rad)
    93
    Bio-Rad fitc conjugated anti cd34
    Fitc Conjugated Anti Cd34, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34+fitc/Rat+anti+Mouse+IgG2a+Heavy+Chain/pmc12286334-74-9-11
    Average 93 stars, based on 1 article reviews
    fitc conjugated anti cd34 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results